Gather clinical information about children with WS phenotype, including their medical history, pedigree, and imaging and hearing tests, with their informed consent. To find the genes linked to hearing loss, gather peripheral blood, extract genomic DNA, and apply high-throughput sequencing techniques. Conduct a temporal bone CT scan on the proband to assess inner ear development. Test the proband's and their family members' peripheral blood using flow cytometry. The child was diagnosed with inner ear developmental defects and one heterozygous mutation (c.77_104delGGAGCGCGCCTCTAGGGCCCGACGG) in the SOX10 gene, which resulted in a frameshift mutation in amino acids (p.G26Afs * 74). No such mutation was discovered, and the parents' phenotypic was normal. The proband's reduced expression of SOX10, PAX3, and MITF proteins was discovered by flow cytometry detection.Ultimately, we think that this research has found a new case of SOX10 mutation, which is a spontaneous mutation in the patient and preliminarily identified as the cause of the disease. This mutation enriches the mutation spectrum of SOX10.

Li Xia, Zhao Heng, Ma Xiuli, Ding Chaohong, Ma Jing. Genotype and phenotype analysis of a family with Waardenburg syndrome type Ⅱ caused by a de novo mutation in SOX10 gene. Frontiers in Medical Science Research (2024), Vol. 6, Issue 4: 11-19. https://doi.org/10.25236/FMSR.2024.060402.

[1] Waardenburg P J. A new syndrome combining developmental anomalies of the eyelids, eyebrows, and nose root with pigmentary defects of the iris and head hair and with congenital deafness [J]. Am J Hum Genet, 1951, 3(3): 195-253

[2] Zhang W, Xiao L, Chen B, Xu Y, Yan N. 22q12.3-q13.1 microdeletion including SOX10 causes atypical Waardenburg syndrome [J]. Eur J Ophthalmol, 2021, 31(4): 2127-2134

[3] Agrawal R, Walia S. Waardenburg Syndrome Type 1[J]. Indian J Ophthalmol, 2022, 70(7): 2679-2681

[4] Wei Kaihui, Jiang Qian, Zhang Zhen, Li Qi, Xiao Ping, Su Lin, Zou Jizhen, Li Long, Pan Shangling A novel mutation study of the SOX10 gene in children with Waardenburg syndrome type IV [J] Chinese Journal of Otology, 2016, 14 (02): 240-246

[5] Yang S, Wang C, Zhou C, Kang D, Zhang X, Yuan H. A follow-up study of a Chinese family with Waardenburg syndrome type II caused by a truncating mutation of the MITF gene [J]. Mol Genet Genomic Med, 2020, 8(12): e1520

[6] Huang S, Song J, He C, Cai X, Yuan K, Mei L, Feng Y. Genetic insights, disease mechanisms, and biological therapeutics for Waardenburg syndrome[J]. Gene Ther, 2022, 29(9): 479-497

[7] Xu Guangyu, Hao Qingqing, Zhong Lingling, Ren Wei, Yan Yan, Liu Riyuan, Li Jianan, Guo Weiwei, Zhao Hui. The effect of SOX10 gene mutation on inner ear development in patients with Waardenburg syndrome [J]. Chinese Journal of Otolaryngology Head and Neck Surgery, 2016, 51 (11): 832-837

[8] Harris ML, Baxter L L, Loftus S K, Pavan W J. Sox proteins in melanocyte development and melanoma[J]. Pigment Cell Melanoma Res, 2010, 23(4): 496-513

[9] Haldin C E, Labonne C. SoxE factors as multifunctional neural crest regulatory factors[J]. Int J Biochem Cell Biol, 2010, 42(3): 441-444

[10] Eckhard A, Gleiser C, Rask-Andersen H, Arnold H, Liu W, Mack A, Muller M, Lowenheim H, Hirt B. Co-localisation of K(ir)4.1 and AQP4 in rat and human cochleae reveals a gap in water channel expression at the transduction sites of endocochlear K(+) recycling routes[J]. Cell Tissue Res, 2012, 350(1): 27-43

[11] Pingault V, Ente D, Dastot-Le M F, Goossens M, Marlin S, Bondurant N. Review and update of mutations causing Waardenburg syndrome[J]. Hum Mutat, 2010, 31(4): 391-406

[12] Sinner D, Kordich J J, Spence J R, Opoka R, Rankin S, Lin S C, Jonatan D, Zorn A M, Wells J M. Sox17 and Sox4 differentially regulate beta-catenin/T-cell factor activity and proliferation of colon carcinoma cells[J]. Mol Cell Biol, 2007, 27(22): 7802-7815

[13] Hao Qingqing, Hou Kun, Zhong Lingling, Ren Wei, Guo Weiwei, Yang Shiming. The role of SOX10 gene in inner ear development [J]. Chinese Journal of Otology, 2017, 15 (02): 245-248

[14] Rehberg S, Lischka P, Glaser G, Stamminger T, Wegner M, Rosorius O. Sox10 is an active nucleocytoplasmic shuttle protein, and shuttling is crucial for Sox10-mediated transactivation[J]. Mol Cell Biol, 2002, 22(16): 5826-5834

[15] Jiang L, Chen H, Jiang W, Hu Z, Mei L, Xue J, He C, Liu Y, Xia K, Feng Y. Novel mutations in the SOX10 gene in the first two Chinese cases of type IV  Waardenburg syndrome[J]. Biochem Biophys Res Commun, 2011, 408(4): 620-624

[16] Wang Y, Chai Y, Zhang P, Zang W. A novel variant of the SOX10 gene associated with Waardenburg syndrome type IV [J]. BMC Med Genomics, 2023, 16(1): 147

[17] Xu G Y, Hao Q Q, Zhong L L, Ren W, Yan Y, Liu R Y, Li J N, Guo W W, Zhao H, Yang S M. [SOX10 mutation is relevant to inner ear malformation in patients with  Waardenburg syndrome][J]. Chinese Journal of Otorhinolaryngology Head and Neck Surgery, 2016, 51(11): 832-837

[18] Locher H, Frijns J H, van Iperen L, de Groot J C, Huisman M A, Chuva D S L S. Neurosensory development and cell fate determination in the human cochlea[J]. Neural Dev, 2013, 8: 20

[19] Bondurant N, Kobetz A, Pingault V, Lemort N, Encha-Razavi F, Couly G, Goderich D E, Wegner M, Abitbol M, Goossens M. Expression of the SOX10 gene during human development[J]. FEBS Lett, 1998, 432(3): 168-172

[20] Breuskin I, Bodson M, Thelen N, Thiry M, Borgs L, Nguyen L, Lefebvre P P, Malgrange B. Sox10 promotes the survival of cochlear progenitors during the establishment of the organ of Corti [J]. Dev Biol, 2009, 335(2): 327-339

[21] Bondurant N, Pingault V, Goderich D E, Lemort N, Sock E, Le Caignec C, Wegner M, Goossens M. Interaction among SOX10, PAX3, and MITF, three genes altered in Waardenburg syndrome[J]. Hum Mol Genet, 2000, 9(13): 1907-1917

[22] Tachibana M. A cascade of genes related to Waardenburg syndrome [J]. J Investig Dermatol Symp Proc, 1999, 4(2): 126-129